Author Archives: Richard Wintle

About Richard Wintle

I am Canadian by heritage, and a molecular biologist and human geneticist by training. My day job is Assistant Director of a large genome centre, where I do various things along the lines of "keeping the wheels on". In my spare time, I tend to run around with a camera, often chasing horses, race cars, musicians, and occasionally, wildlife.

Science Policy and the Canadian Election – or maybe not.

Posted on May 1, 2011 by Richard Wintle

So we’re down to it – only one day left until the Canadian Federal Election, although many who are more organized than I am have already voted in the advance polls. As usual, our beloved national broadcaster has aggregated a … Continue reading →

Posted in Funding, Guest posts, Politics, Uncategorized | Tagged , , , , , | 12 Comments

The Age of Fulfilment

Posted on February 8, 2011 by Richard Wintle

In which the author exhibits his cheap and lazy nature by faffling around a bit, eventually buying Jenny Rohn’s latest novel “The Honest Look” via several geographically separated countries. Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , , | 10 Comments

Genome Assembly – a primer for the Shakespeare fan

Posted on December 31, 2010 by Richard Wintle

“Assembly” is the process of putting millions of tiny DNA sequences together to make a full genome. Neither William Shakespeare, nor Julius Caesar, knew anything about it, but that’s not stopping me from using the play to help try to explain it. Continue reading →

Posted in Education, Guest posts | Tagged , , , , | 25 Comments

PubMed – again (a.k.a. “lazy cross-posting”)

Posted on December 15, 2010 by Richard Wintle

While I continue to tee up my next Magnus Opus, this time about Shakespeare and genome assembly, I’ll indulge in a little lazy blogging cross-posting and point you to another of my haunts, the Life Science Tools of the Trade … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , , , , | 4 Comments

Genome sequencing, Shakespeare style

Posted on December 11, 2010 by Richard Wintle

What is a genome sequence, and how does mine differ from everyone else’s? We turn to William Shakespeare to help us find out. Continue reading →

Posted in Education, Guest posts | Tagged , , , | 28 Comments

Ah, to heck with the launch date…

Posted on December 8, 2010 by Richard Wintle

…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , | 8 Comments