About the Irregulars
The Occam’s Typewriter Irregulars is a place for guest bloggers to write. Some of these writers might in time have their own blog on OT; others might simply have been invited (or they asked!) to contribute a one- (or two- or three-) off post. Enjoy!-
Recent Posts
Recent Comments
- Vladimir Vojtech on So who is she then?
- Nicola Spaldin on So who is she then?
- Vladimir Vojtech on So who is she then?
- Nicola Spaldin on Eternal Questions
- Heather on Eternal Questions
Archives
- October 2021
- October 2017
- September 2017
- July 2017
- June 2017
- January 2016
- November 2015
- December 2014
- August 2014
- July 2014
- June 2014
- March 2014
- February 2014
- January 2014
- December 2013
- November 2013
- October 2013
- September 2013
- August 2013
- July 2013
- June 2013
- May 2013
- April 2013
- March 2013
- February 2013
- January 2013
- December 2012
- November 2012
- October 2012
- February 2012
- January 2012
- December 2011
- November 2011
- October 2011
- September 2011
- August 2011
- May 2011
- April 2011
- February 2011
- January 2011
- December 2010
Categories
Meta
Tag Archives: DNA
Sympathy or schadenfreude? – the ENCODE consortium gets the hatchet job.
A paper was published earlier this week making an extraordinary attack on the integrity of the work of the ENCODE consortium, an international group studying the human genome. Scientists don’t normally go in for this type of public blood letting, … Continue reading
Posted in Guest posts, Uncategorized
Tagged Dan Graur, DNA, ENCODE, Hatchet Job of the Year, human genome, Rachel Cusk
2 Comments
Genome Assembly – a primer for the Shakespeare fan
“Assembly” is the process of putting millions of tiny DNA sequences together to make a full genome. Neither William Shakespeare, nor Julius Caesar, knew anything about it, but that’s not stopping me from using the play to help try to explain it. Continue reading
Posted in Education, Guest posts
Tagged assembly, DNA, gratuitous photography, sequencing, Shakespeare
25 Comments
Genome sequencing, Shakespeare style
What is a genome sequence, and how does mine differ from everyone else’s? We turn to William Shakespeare to help us find out. Continue reading
Ah, to heck with the launch date…
…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading
