About the Irregulars
The Occam’s Typewriter Irregulars is a place for guest bloggers to write. Some of these writers might in time have their own blog on OT; others might simply have been invited (or they asked!) to contribute a one- (or two- or three-) off post. Enjoy!-
Recent Posts
Recent Comments
- Vladimir Vojtech on So who is she then?
- Nicola Spaldin on So who is she then?
- Vladimir Vojtech on So who is she then?
- Nicola Spaldin on Eternal Questions
- Heather on Eternal Questions
Archives
- October 2021
- October 2017
- September 2017
- July 2017
- June 2017
- January 2016
- November 2015
- December 2014
- August 2014
- July 2014
- June 2014
- March 2014
- February 2014
- January 2014
- December 2013
- November 2013
- October 2013
- September 2013
- August 2013
- July 2013
- June 2013
- May 2013
- April 2013
- March 2013
- February 2013
- January 2013
- December 2012
- November 2012
- October 2012
- February 2012
- January 2012
- December 2011
- November 2011
- October 2011
- September 2011
- August 2011
- May 2011
- April 2011
- February 2011
- January 2011
- December 2010
Categories
Meta
Tag Archives: sequence
Ah, to heck with the launch date…
…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading