Monthly Archives: December 2010

Genome Assembly – a primer for the Shakespeare fan

“Assembly” is the process of putting millions of tiny DNA sequences together to make a full genome. Neither William Shakespeare, nor Julius Caesar, knew anything about it, but that’s not stopping me from using the play to help try to explain it. Continue reading →

Posted in Education, Guest posts | Tagged , , , , | 25 Comments

Informal Science

While I feel compelled to address various “weighty” issues in science, after a long year (well really, they’re all the same except for leap-years, but it feels like it)—I think I will opt for the lighter side at this time. … Continue reading →

Posted in Uncategorized | 17 Comments

The Age of Reason

Inevitably, it happens to us all. Some of us succumb quietly, with crow’s feet pulling on the corners of their eyes and ‘love handles’ attaching to our midsections. Others put up a valiant battle, sweating in the gym and avoiding … Continue reading →

Posted in Uncategorized | 9 Comments

Early exposure to skeptical thinking: navigating the chicken and egg syndrome

I live in the midwest area of the United States, where sidewalks in neighborhoods are a luxury, and you are a “nobody” if you don’t own a car. Or two. And a pickup truck—the bigger the better. Cars and driving … Continue reading →

Posted in Uncategorized | 12 Comments

PubMed – again (a.k.a. “lazy cross-posting”)

While I continue to tee up my next Magnus Opus, this time about Shakespeare and genome assembly, I’ll indulge in a little lazy blogging cross-posting and point you to another of my haunts, the Life Science Tools of the Trade … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , , , , | 4 Comments

Genome sequencing, Shakespeare style

What is a genome sequence, and how does mine differ from everyone else’s? We turn to William Shakespeare to help us find out. Continue reading →

Posted in Education, Guest posts | Tagged , , , | 28 Comments

Reflections on the aftermath of a student protest

I didn’t attend the student protests- except in the sense I walked down the South Bank (other side of the river from Parliament) where my walk home was curiously unencumbered by traffic and I heard the  hum of helicopters over … Continue reading →

Posted in Meta | Tagged | 11 Comments

Ah, to heck with the launch date…

…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , | 8 Comments

Welcome

The Occam’s Typewriter Irregulars is a place for guest bloggers to write. Some of these writers might in time have their own blog on OT; others might simply have been invited (or they asked!) to contribute a one- (or two- … Continue reading →

Posted in Meta | Tagged | 11 Comments