Ah, to heck with the launch date…

Posted on December 8, 2010 by Richard Wintle

…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch.

Besides, every good science blogging community needs some DNA sequence, surely?

sequencing gel, circa 1995

ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG

I’ll get my coat now.

EDIT – I broke it. html image embedding and line wrap DNW. Sorry guys.

EDIT – rpg fixed it again. Isn’t that picture lovely?

About Richard Wintle

I am Canadian by heritage, and a molecular biologist and human geneticist by training. My day job is Assistant Director of a large genome centre, where I do various things along the lines of "keeping the wheels on". In my spare time, I tend to run around with a camera, often chasing horses, race cars, musicians, and occasionally, wildlife.
This entry was posted in Guest posts, Uncategorized and tagged , , , . Bookmark the permalink.

8 Responses to Ah, to heck with the launch date…

  1. cromercrox says:
    December 8, 2010 at 5:07 am

    snigger.

  2. rpg says:
    December 8, 2010 at 8:15 am

    HTML image embedding is fine—but you have to enter HTML in the ‘HTML’ editor, NOT the visual editor. That one’s your fault 🙂

    I’ve fixed the line wrap issue: all long lines are now forced to wrap.

  3. ricardipus says:
    December 8, 2010 at 3:20 pm

    HTML editor? What is this magic?

    [sidebar discussion of automagic html parsing in WordPress visual editor omitted]

    All fixed now, thank you.

  4. chall says:
    December 9, 2010 at 10:45 pm

    🙂

    the big question is; what DNA sequence is it?!?! A strange animal…. the code for the magic behind the scenes… endless possibilities …

  5. ricardipus says:
    December 10, 2010 at 12:47 pm

    Chall – if you are really ambitious, you could read a bit of the gel (making some judicious guesses about how the lanes are arranged), BLAST it against NCBI’s non-redundant database of DNA sequences, and find out (possibly using information about my dim and distant research history to help inform your search).

    Or, you could just click through to the Flickr image to find out. 🙂

  6. chall says:
    December 10, 2010 at 11:42 pm

    I guess I am not very ambitious ^^ I guess I could click on the photo when I got home (flickr is one of those sites not accessible from work)

    all good now 🙂

Comments are closed.