Category Archives: Guest posts

Informed consent?

Posted on January 5, 2011 by Fi Douglas

The term “informed consent” implies that patients need to be aware of any possible benefits, risks and complications before agreeing to commence with a treatment. Most patients don’t have a medical or scientific background, so it is not practical for … Continue reading →

Posted in Guest posts | Tagged , , , , , | 12 Comments

Criminal leadership: a bad situation for citizens and scientists

Posted on January 3, 2011 by Steve Caplan

Happy New Year to everyone. And while many countries celebrated the coming year, not in every country is the New Year based on the Gregorian Calendar. And not in every country was the New Year’s break a happy time. The … Continue reading →

Posted in Guest posts | Tagged , , , , , , | 7 Comments

Genome Assembly – a primer for the Shakespeare fan

Posted on December 31, 2010 by Richard Wintle

“Assembly” is the process of putting millions of tiny DNA sequences together to make a full genome. Neither William Shakespeare, nor Julius Caesar, knew anything about it, but that’s not stopping me from using the play to help try to explain it. Continue reading →

Posted in Education, Guest posts | Tagged , , , , | 25 Comments

PubMed – again (a.k.a. “lazy cross-posting”)

Posted on December 15, 2010 by Richard Wintle

While I continue to tee up my next Magnus Opus, this time about Shakespeare and genome assembly, I’ll indulge in a little lazy blogging cross-posting and point you to another of my haunts, the Life Science Tools of the Trade … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , , , , | 4 Comments

Genome sequencing, Shakespeare style

Posted on December 11, 2010 by Richard Wintle

What is a genome sequence, and how does mine differ from everyone else’s? We turn to William Shakespeare to help us find out. Continue reading →

Posted in Education, Guest posts | Tagged , , , | 28 Comments

Ah, to heck with the launch date…

Posted on December 8, 2010 by Richard Wintle

…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , | 8 Comments