Category Archives: Uncategorized

Informal Science

While I feel compelled to address various “weighty” issues in science, after a long year (well really, they’re all the same except for leap-years, but it feels like it)—I think I will opt for the lighter side at this time. … Continue reading →

Posted in Uncategorized | 17 Comments

The Age of Reason

Inevitably, it happens to us all. Some of us succumb quietly, with crow’s feet pulling on the corners of their eyes and ‘love handles’ attaching to our midsections. Others put up a valiant battle, sweating in the gym and avoiding … Continue reading →

Posted in Uncategorized | 9 Comments

Early exposure to skeptical thinking: navigating the chicken and egg syndrome

I live in the midwest area of the United States, where sidewalks in neighborhoods are a luxury, and you are a “nobody” if you don’t own a car. Or two. And a pickup truck—the bigger the better. Cars and driving … Continue reading →

Posted in Uncategorized | 12 Comments

PubMed – again (a.k.a. “lazy cross-posting”)

While I continue to tee up my next Magnus Opus, this time about Shakespeare and genome assembly, I’ll indulge in a little lazy blogging cross-posting and point you to another of my haunts, the Life Science Tools of the Trade … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , , , , | 4 Comments

Ah, to heck with the launch date…

…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading →

Posted in Guest posts, Uncategorized | Tagged , , , | 8 Comments