About the Irregulars
The Occam’s Typewriter Irregulars is a place for guest bloggers to write. Some of these writers might in time have their own blog on OT; others might simply have been invited (or they asked!) to contribute a one- (or two- or three-) off post. Enjoy!-
Recent Posts
Recent Comments
- Vladimir Vojtech on So who is she then?
- Nicola Spaldin on So who is she then?
- Vladimir Vojtech on So who is she then?
- Nicola Spaldin on Eternal Questions
- Heather on Eternal Questions
Archives
- October 2021
- October 2017
- September 2017
- July 2017
- June 2017
- January 2016
- November 2015
- December 2014
- August 2014
- July 2014
- June 2014
- March 2014
- February 2014
- January 2014
- December 2013
- November 2013
- October 2013
- September 2013
- August 2013
- July 2013
- June 2013
- May 2013
- April 2013
- March 2013
- February 2013
- January 2013
- December 2012
- November 2012
- October 2012
- February 2012
- January 2012
- December 2011
- November 2011
- October 2011
- September 2011
- August 2011
- May 2011
- April 2011
- February 2011
- January 2011
- December 2010
Categories
Meta
Category Archives: Uncategorized
Informal Science
While I feel compelled to address various “weighty” issues in science, after a long year (well really, they’re all the same except for leap-years, but it feels like it)—I think I will opt for the lighter side at this time. … Continue reading
Posted in Uncategorized
17 Comments
The Age of Reason
Inevitably, it happens to us all. Some of us succumb quietly, with crow’s feet pulling on the corners of their eyes and ‘love handles’ attaching to our midsections. Others put up a valiant battle, sweating in the gym and avoiding … Continue reading
Posted in Uncategorized
9 Comments
Early exposure to skeptical thinking: navigating the chicken and egg syndrome
I live in the midwest area of the United States, where sidewalks in neighborhoods are a luxury, and you are a “nobody” if you don’t own a car. Or two. And a pickup truck—the bigger the better. Cars and driving … Continue reading
Posted in Uncategorized
12 Comments
PubMed – again (a.k.a. “lazy cross-posting”)
While I continue to tee up my next Magnus Opus, this time about Shakespeare and genome assembly, I’ll indulge in a little lazy blogging cross-posting and point you to another of my haunts, the Life Science Tools of the Trade … Continue reading
Posted in Guest posts, Uncategorized
Tagged cross posting, FAIL, Google Scholar, lazy blogging, LSTOTT, PubMed, Scholar
4 Comments
Ah, to heck with the launch date…
…let’s kick the tires a bit, shall we? I’m sure the Occam’s Typewriter admins will cut this out (geddit?) later if things need to be cleaned up pre-official-launch. Besides, every good science blogging community needs some DNA sequence, surely? ATTTCGTACGTAGCTCGTACGTACGTACGTACGTAGCTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGTGCTAGTCGTAGCTAGCTACTAGTCGTCGATGCTACGTAGCTACATCGTAGCTAGCTAGCTAGCTGCTGTACGTAGTAGTAGTCAGTCAGCTAGCTAGCTAG … Continue reading
